Journal:

Article Title: Enteric Salmonellosis Disrupts the Microbial Ecology of the Murine Gastrointestinal Tract ▿

doi: 10.1128/IAI.01432-07

Figure Lengend Snippet: 16S rRNA gene group-specific and kingdom-specific primers for qPCR a

Article Snippet: Clostridium coccoides , ATCC 27340D , C.cocR491 , GCTTCTTAGTCAGGTACCGTCAT , 60 , .

Techniques: Sequencing, Bacteria, Plasmid Preparation

Journal:

Article Title: Enteric Salmonellosis Disrupts the Microbial Ecology of the Murine Gastrointestinal Tract ▿

doi: 10.1128/IAI.01432-07

Figure Lengend Snippet: Quantitative analysis of the intestinal microbiota after intestinal clearance of S. enterica serovar Typhimurium. Mice were inoculated with 107 CFU S. enterica serovar Typhimurium and sacrificed after 30 days. The intestinal tract was removed and divided into the DSI, cecum, and LI. Bacterial genomic DNA was isolated from each segment, and qPCR analysis was performed to determine the abundance of specific commensal bacterial groups in the DSI (a) and cecum (b). White bars represent uninfected controls. Black bars represent Salmonella-infected mice. Salmonella infection did not appear to affect the bacterial numbers in any segment of the gut (P > 0.05). BT, below the detection threshold of qPCR. Erec, Eubacterium rectale/Clostridium coccoides; Lact, Lactobacillus sp.; Bact, Bacteroides sp.; MIB, mouse intestinal Bacteroides; Sfb, segmented filamentous bacteria; Ent, Enterobacteriaceae; C. perf, Clostridium perfringens; Salm, S. enterica serovar Typhimurium.

Article Snippet: Clostridium coccoides , ATCC 27340D , C.cocR491 , GCTTCTTAGTCAGGTACCGTCAT , 60 , .

Techniques: Isolation, Infection, Bacteria

Journal:

Article Title: Enteric Salmonellosis Disrupts the Microbial Ecology of the Murine Gastrointestinal Tract ▿

doi: 10.1128/IAI.01432-07

Figure Lengend Snippet: Quantitative analysis of intestinal microbiota 3 days after infection with 108 CFU S. enterica serovar Typhimurium. Mice were inoculated with 108 S. enterica serovar Typhimurium organisms and sacrificed after 3 days. The intestinal tract was removed and divided into the DSI, cecum, and LI. Bacterial genomic DNA was isolated from each segment, and qPCR analysis measured the abundance of specific commensal bacterial groups in the DSI (a), cecum (b), and LI (c). White bars represent uninfected controls. Black bars represent Salmonella-infected mice. In the DSI, Salmonella infection did affect bacterial counts (P < 0.05), and the effect was not uniform across groups (P < 0.05). The asterisk represents the post hoc t test for the Lactobacillus sp. group (P < 0.005). Salmonella infection did not appear to affect the cecum or LI (P > 0.05). BT, below the detection threshold of qPCR. Erec, Eubacterium rectale/Clostridium coccoides; Lact, Lactobacillus sp.; Bact, Bacteroides sp.; MIB, mouse intestinal Bacteroides; Sfb, segmented filamentous bacteria; Ent, Enterobacteriaceae; C. perf, Clostridium perfringens; Salm, S. enterica serovar Typhimurium.

Article Snippet: Clostridium coccoides , ATCC 27340D , C.cocR491 , GCTTCTTAGTCAGGTACCGTCAT , 60 , .

Techniques: Infection, Isolation, Bacteria

Journal:

Article Title: Enteric Salmonellosis Disrupts the Microbial Ecology of the Murine Gastrointestinal Tract ▿

doi: 10.1128/IAI.01432-07

Figure Lengend Snippet: Quantitative analysis of intestinal microbiota 7 days after infection with 108 CFU S. enterica serovar Typhimurium. Mice were inoculated with 108 S. enterica serovar Typhimurium organisms and sacrificed after 7 days. The intestinal tract was removed and divided into the DSI, cecum, and LI. Bacterial genomic DNA was isolated from each segment, and qPCR analysis measured the abundance of specific commensal bacterial groups in the DSI (a), cecum (b), and LI (c). White bars represent uninfected controls. Black bars represent Salmonella-infected mice. Salmonella infection did affect bacterial counts in the DSI (P < 0.0001), cecum (P < 0.0001), and LI (P < 0.0001), and the effects were not uniform across groups (P < 0.0001 for all segments). Asterisks represent the post hoc t test for the designated groups (P < 0.05). BT, below the detection threshold of qPCR. Erec, Eubacterium rectale/Clostridium coccoides; Lact, Lactobacillus sp.; Bact, Bacteroides sp.; MIB, mouse intestinal Bacteroides; Sfb, segmented filamentous bacteria; Ent, Enterobacteriaceae; C. perf, Clostridium perfringens; Salm, S. enterica serovar Typhimurium.

Article Snippet: Clostridium coccoides , ATCC 27340D , C.cocR491 , GCTTCTTAGTCAGGTACCGTCAT , 60 , .

Techniques: Infection, Isolation, Bacteria

Journal:

Article Title: Enteric Salmonellosis Disrupts the Microbial Ecology of the Murine Gastrointestinal Tract ▿

doi: 10.1128/IAI.01432-07

Figure Lengend Snippet: Impact of SPI1 and SPI2 Salmonella mutants on the intestinal microbiota. Mice were inoculated perorally with 108 CFU of S. enterica serovar Typhimurium TK93 (SPI1 mutant) or 5SAT (SPI2 mutant) and were sacrificed after 3 days. The intestinal tract was removed and divided into the DSI, cecum, and LI. (a) Cecal weights were obtained and compared between control and infected mice. Black squares represent uninfected control mice. Black triangles represent Salmonella-infected mice. (b) Bacterial genomic DNA was isolated from the DSI of mice infected with the SPI1 mutant (b) and the SPI2 mutant (c), and qPCR analysis determining the abundance of specific commensal groups was performed. White bars represent uninfected controls. Black bars represent Salmonella-infected mice. The asterisk represents the post hoc t test for the designated group (P < 0.05). Erec, Eubacterium rectale/Clostridium coccoides; Lact, Lactobacillus sp.; Bact, Bacteroides sp.; MIB, mouse intestinal Bacteroides; Sfb, segmented filamentous bacteria.

Article Snippet: Clostridium coccoides , ATCC 27340D , C.cocR491 , GCTTCTTAGTCAGGTACCGTCAT , 60 , .

Techniques: Mutagenesis, Control, Infection, Isolation, Bacteria

Journal:

Article Title: Enteric Salmonellosis Disrupts the Microbial Ecology of the Murine Gastrointestinal Tract ▿

doi: 10.1128/IAI.01432-07

Figure Lengend Snippet: Quantitative analysis of the intestinal microbiota after 7 days of infection with 107 CFU S. enterica serovar Typhimurium. Mice were inoculated perorally with 107 CFU S. enterica serovar Typhimurium and sacrificed after 7 days. The intestinal tract was removed and divided into the DSI, cecum, and LI. Bacterial genomic DNA was isolated from each segment, and qPCR analysis was performed to determine the abundance of specific commensal bacterial groups in the DSI (a), cecum (b), and LI (c). White bars represent uninfected controls. Black bars represent Salmonella-infected mice. Salmonella infection did affect bacterial counts in the cecum (P < 0.005) and the LI (P < 0.05), and the effects were not uniform across groups. Asterisks represent the post hoc t test for the designated groups (P < 0.005). Salmonella infection did not appear to affect the bacterial counts in the small intestine (P > 0.05). BT, below the detection threshold of qPCR. Erec, Eubacterium rectale/Clostridium coccoides; Lact, Lactobacillus sp.; Bact, Bacteroides sp.; MIB, mouse intestinal Bacteroides; Sfb, segmented filamentous bacteria; Ent, Enterobacteriaceae; C. perf, Clostridium perfringens; Salm, S. enterica serovar Typhimurium.

Article Snippet: Clostridium coccoides , ATCC 27340D , C.cocR491 , GCTTCTTAGTCAGGTACCGTCAT , 60 , .

Techniques: Infection, Isolation, Bacteria